возможен запуск мониторов Dell как один монитор с МВА 2013

Я медленно начинаю увеличивать свою рабочую частоту (среднее расстояние 5-7км) после спорадических пару месяцев с травмой.

Я замечаю, что мои ноги всегда болят и очень плотно/закачивается при запуске. Я не новичок в бега, но я нахожу, что моя камбаловидной остается очень болит 5+ дней после запуска.

Я протягиваю немного позже и изредка используйте поролоновый валик. Это самый болезненный спускаясь по лестнице.

Какие-либо предложения?

+24
user77823 20 июл. 2010 г., 12:38:46
18 ответов

На что я могу привезти страница не список это явно, но это не список телефонов зарядные устройства, которые аналогичны по функции, но также хлебопечки, ноутбуки, Швейные машины, которые требуют постоянного и переменного тока единиц. Также инвертор. Если вы хотите быть на 100% уверены

Для элементов, не указанных здесь, просто привязать фотографию или отправить вопрос AskTSA на Facebook Посланника или Твиттере. Мы будем рады ответить на ваши вопросы с 8 утра до 10 вечера по восточному времени в будние дни; 9 утра до 7 вечера в выходные/праздничные дни.

+943
Liverpoolhelp 03 февр. '09 в 4:24

Я решил случайно взглянуть на моем каталоге /etc, и я видел некоторые записи такой:

пароль
пароль-
тень
тень-
subgid
subgid-

Я знаю, что они дефисы (-) и не Тильды (~). Каковы файлы с суффиксом дефис Для (в отличие от их не hyphened аналоги)?

+909
tomikedos 2 апр. 2020 г., 06:09:55
Другие ответы

Связанные вопросы


Похожие вопросы

Моя сестра с такой же проблемой! Она получила силикагель мяч застрял ее касания iPod 4 гнезду. Я использовал иглу (швейную) и "уничтожили" кремнезема мяч. Потребовалось некоторое время, но он работал!

+776
user17371 20 мая 2021 г., 04:18:18

Два пункта:

  1. Нет необходимости для команды первый "экспорт"
  2. Мне кажется у вас есть свой vertx_home установить неправильно, так как Ваш эффективный путь: /Анто/Вертекс/Бен - /Бен - обратите внимание на повторение 'бин'

Предлагаю изменить ваш .bashrc и читать следующим образом:

vertx_home=/Анто/vertx 
экспортировать переменную PATH=$PATH: в vertx_home$/бин

Закройте все открытые терминалы для изменения вступили в силу.

+728
ggblade 4 сент. 2014 г., 10:40:51

Я использую Bogofilter как мой клиент плагин фильтра и Spamassasin на сервере. Так что у меня есть лучшее из обоих миров ;).

В любом случае я считаю, что Spamassasin работает лучше, без подготовки, поэтому я положил его на сервер. Это просто ощущение, абсолютно субъективное, основанное только на личном опыте, так что не стесняйтесь, чтобы игнорировать.

+706
Dhruv Mundru 11 мар. 2017 г., 18:44:10

Может быть, не лучший ответ, но надеюсь, это может помочь немного.

Не знаю, почему у вас нет вариантов у меня. Но это может быть потому, что у вас есть макбук.

Вот как это выглядит на моем Макбук Про: enter image description here

Я на самом деле использовать приложение под названием кофеин:

Кофеин-это крошечная программа, которая ставит иконку в правой части панели меню. Нажмите на нее, чтобы предотвратить ваш Mac из режима сна, затемнение экрана или запуска заставки. Нажмите ее снова, чтобы вернуться. Щелкните правой кнопкой мыши (или ⌘-нажать) на значок, чтобы отобразить меню.

Но как вы можете читать это также предотвращает экран от затемнения.

+693
Jon B 21 сент. 2022 г., 06:33:28

Я считаю, что если вы режете/соскрести плесень остальное будет хорошо.

С огромный кусок, завернутый и охлажденных пармиджано реджано, например, у меня было соскребать его до решетки, за 18 месяцев без каких-либо последствий.

+689
Roselene 6 янв. 2019 г., 07:59:17

Это, безусловно, возможно, но вам придется написать свой собственный прожектор импортер метаданные для базы данных Outlook, потому что денег нет.

Уровень сложности: Hard

Вот документация https://developer.apple.com/library/mac/#documentation/Carbon/Conceptual/MDImporters/MDImporters.html

+684
Josu Barrado 4 нояб. 2014 г., 04:07:26

Внезапно и без предупреждения, я потерял воспроизведение звука в Ubuntu 12.04. Нет звука при запуске нет MP3, ни Ютуб аудио. Я скачал громкости аудио приложение контроль пульса; она оживляет звук, который должен играть.

Моя система с двойной загрузкой. Когда я загрузиться в Windows Vista, я вам звук, но он заикается; что есть, я вам в пол-второго звука, затем мгновение тишины, и эта последовательность повторяется, обеспечивая прерывистый звук, как будто из другой стороне вращающегося вентилятора.

Наконец-то я попробовала с помощью LiveUSB Федора. Звук нормально.

Я в основном связана с Ubuntu здесь, так как это моя основная система. Я включаю выход игре -я команда ниже. Спасибо заранее.

объект [root@localhost в liveuser]# игре -л
**** Список воспроизведения устройств ****
карта 0: видеокарты NVIDIA [HDA, а Нвидиа], устройство 0: ALC268 аналоговой [аналого ALC268]
 Subdevices: 1/1
 Подустройства #0: подустройства #0
карта 0: видеокарты NVIDIA [HDA, а Нвидиа], устройство 1: ALC268 цифровой [цифровой ALC268]
 Subdevices: 1/1
 Подустройства #0: подустройства #0

Обновление: утром я загрузился в Ubuntu и все звук нормально работал. Я загрузился в Windows и звук там тоже работал. Затем я загрузился обратно в Ubuntu и они уже не работали.

+632
Torsten Zenk 1 дек. 2019 г., 02:36:15

Попробуйте установить драйвер Nvidia из RPMFusion. Он отвечает за отключение Nouveau для вас, и вы получите автоматическое обновление, поскольку она использует пальчики оближешь.

+624
sanke 14 окт. 2017 г., 04:04:27

Очень удобным способом является следующий:

Просто введите следующую команду в вашем терминале:

( вставьте-ваше-многострочный скрипт-здесь ) введите

Полное описание:

  1. В терминале вы начинаете с (

    Необязательно: нажмите Ввод (только для форматирования причинам)

  2. Теперь вы можете вставить несколько строк

    например:
    Эхо привет
    Эхо мира

    Альтернатива: вы типа/вставить построчно (окончания каждого С ввести ключ).

  3. Наконец, введите доработке ) и нажмите Ввод снова, которая выполнит весь наклеенная/введенных строк.

Маленький рабочий пример (для оклейки построчно с ввод):

Андерсон@ТП ~ % (
\`subsh> Echo привет
\`subsh> Эхо мира
\`subsh> )
привет
мир
Андерсон@ТП ~ % 

Маленький рабочий пример (для оклейки весь сценарий):

Андерсон@ТП ~ % (
\`subsh> Echo привет
Эхо мира
\`subsh> )
привет
мир
Андерсон@ТП ~ %

Маленький рабочий пример пренебрежения форматирования (для оклейки весь сценарий):

Андерсон@ТП ~ % (Echo привет 
Эхо мира)
привет
мир
Андерсон@ТП ~ % 
+417
AnGel An Gel 17 мар. 2019 г., 11:46:39

Вы пробовали:

apt-получить установку <имя пакета>=<версия>

например
apt-получить установку в Subversion-инструменты=1.3.2-5~bpo1

?

Вы можете проверить версию, например, здесь: http://www.ubuntuupdates.org/pm/google-chrome-stable

+340
Shubhansh Jaiswal 4 авг. 2016 г., 13:07:00

Как включить OpenGL в VLC как видео выход. Он не указан в качестве альтернативного.

+332
d3v1us 20 февр. 2010 г., 03:36:43

Вы не получите новые версии пакетов или ядра в Ubuntu как обычное обновление. Они действительно, однако, обеспечивают исправления безопасности, и это очень важно, поскольку ядро отвечает за все, в том числе все, что связано с загрузкой сетевых драйверов. Ядро-самый важный пакет всегда обновляются. Иначе вы можете вдруг обнаружить, что компьютер используется другими людьми. :)

Некоторые пакеты бывают исключения, такие как Firefox, который поддерживается только в течение короткого времени от Mozilla. По соображениям безопасности, новой версии Firefox обеспечена. В Ubuntu 10.04, до сих пор пользуется Firefox 3.6.24 например, так, что до сих пор не поддерживается Mozilla. Итак, пакет обновлений обычно не имею в виду новые возможности, но только при условии, чтобы исправить небольшие проблемы или чтобы закрыть дыры в безопасности. Они называются стабильно выпускают обновления, и вы можете иногда видеть, как люди относятся к ним как срусь. Вы можете прочитать больше об этом здесь: https://wiki.ubuntu.com/StableReleaseUpdates

Нет такого обновления предназначены, чтобы сломать вашу систему, так что это не возможно, чтобы получить список проблем заранее. Однако, если вы используете Амдс проприетарных драйверов для VGA, то, что, как известно, вызывают проблемы с обновлениями ядра. Решение заключается в том, чтобы удалить проприетарные драйвера до перезагрузки после обновления ядра, а затем переустановить их. Это по-настоящему некрасиво. К счастью, открытой водителей нет таких проблем на всех и просто работать из коробки, когда он работает. :) Они не работают хорошо для всех карт, но на Radeon HD5 и 6-й серии должен хорошо работать.

+247
Azodium 22 мар. 2016 г., 16:59:18

Мобильные телефоны без SIM-карт позволит вам набрать любой из множества стандартных номера экстренных служб, в том числе 999, 911, 112, 000, и, вероятно, другие. Если вы пытаетесь набрать другой номер, то появится сообщение об ошибке. Кроме того, вы можете совершать звонки с заблокированного телефона; есть возможность ввести код безопасности или объявлять чрезвычайное положение. Если у вас чрезвычайное положение, по-видимому, она пробует стандартные номера экстренных служб в последовательности. Источник: запасные мобильного телефона без SIM-карты, что мне довелось иметь под рукой.

+223
Jimmy Okikiola Diamond 25 февр. 2022 г., 15:22:20

Я хочу создать и подписать биткоин транзакцию , используя только bitcoind и Bitcoin-это Кинк'.

Я могу создать транзакцию с помощью createrawtransaction в RPC API, но, подписывая его, используя 'signrawtransaction' не удается.

Обновление: я понял это и ответил себе ниже. Позаботьтесь, чтобы у scriptPubKey правильно и оставить redeemScript пустой для простых операций.

Закрытый ключ не хранится в bitcoindс встроенным бумажник. То есть, пары закрытого и открытого ключей была создана утилита тщеславие (например).

Установки

  • "от" адрес": 1AsJjnWg5QKBThM6mK9jZ8mmo6KUzDjRd (From_Addr_1As)
  • "в" адрес: 1Mu5S5fuztimKZizvYZjKwpYfM9ZFf7zmo (To_Addr_1Mu)
  • сделки, которые направили средства From_Addr_1As: 4325a5db66cbc8e9ff6a585cd0e8a2288ea74f9b46d2972b93f63bbb7d09a23e (Prev_Tx_4325)
  • новая проводка New_Tx

Финансирование

Сделки (Prev_Tx_4325) отправлено 0.00187 BTC на From_Addr_1As: https://blockchain.info/tx/4325a5db66cbc8e9ff6a585cd0e8a2288ea74f9b46d2972b93f63bbb7d09a23e - также рассматривается в адресной сделки вид https://blockchain.info/address/1AsJjnWg5QKBThM6mK9jZ8mmo6KUzDjRD

Я хочу отправить 0.00186 БТЦ от From_Addr_1As в To_Addr_1Mu. На 0.00001 плата БТЦ включены.

Оболочки Bash: создать необработанные транзакции (успешной):

$ ./биткоин-Кинк -rpcpassword=123456 createrawtransaction '[{"txid":"4325a5db66cbc8e9ff6a585cd0e8a2288ea74f9b46d2972b93f63bbb7d09a23e","Uвых":0}]' '{"1AsJjnWg5QKBThM6mK9jZ8mmo6KUzDjRd":0.00186}'

Вывод команды:

01000000013ea2097dbb3bf6932b97d2469b4fa78e28a2e8d05c586affe9c8cb66dba525430000000000ffffffff0190d60200000000001976a91401ddbca1a39b60b54fb671297a4a20a7681e017188ac00000000

Оболочки Bash: раскодировать необработанные транзакции (успешной):

Обратите внимание: 'scriptSig' пуста!

$ ./биткоин-Кинк -rpcpassword=123456 decoderawtransaction 01000000013ea2097dbb3bf6932b97d2469b4fa78e28a2e8d05c586affe9c8cb66dba525430000000000ffffffff0190d60200000000001976a91401ddbca1a39b60b54fb671297a4a20a7681e017188ac00000000

Вывод команды:

{ "txid" : "b1ff3da36a6d7c3aaaee41428a7e239baa6243e37d7e1db60ea022d9f994ec52", "версии" : 1, "locktime" : 0, "Альвин" : [ { "txid" : "4325a5db66cbc8e9ff6a585cd0e8a2288ea74f9b46d2972b93f63bbb7d09a23e", "Uвых" : 0, "scriptSig" : { "АСМ" : "", "наговор" : "" }, "последовательности" : 4294967295 } ], "Uвых" : [ { "значение" : 0.00186000, "н" : 0, "scriptPubKey" : { "АСМ" : "OP_DUP OP_HASH160 01ddbca1a39b60b54fb671297a4a20a7681e0171 OP_EQUALVERIFY OP_CHECKSIG", "наговор" : "76a91401ddbca1a39b60b54fb671297a4a20a7681e017188ac", "reqSigs" : 1, "тип" : "pubkeyhash", "адреса" : [ "1AsJjnWg5QKBThM6mK9jZ8mmo6KUzDjRd" ] } } ] }

Оболочки Bash: знак необработанные транзакции (успешной):

Обратите внимание:

  • scriptPubKey копируется из Prev_Tx_4325
  • redeemScript остается пустая строка: ""

./биткоин-Кинк -rpcpassword=123456 signrawtransaction "01000000013ea2097dbb3bf6932b97d2469b4fa78e28a2e8d05c586affe9c8cb66dba525430000000000ffffffff0190d60200000000001976a91401ddbca1a39b60b54fb671297a4a20a7681e017188ac00000000" '[{"txid":"4325a5db66cbc8e9ff6a585cd0e8a2288ea74f9b46d2972b93f63bbb7d09a23e","vout":0,"scriptPubKey":"76a91401ddbca1a39b60b54fb671297a4a20a7681e017188ac","redeemScript":""}]' '[" 5J34hLVaP9UAj4BcdbgYoPia93zzDfo8jhtzun2tf8qqrizqtjy"]' "все"

Вывод команды:

{ "наговор" : "01000000013ea2097dbb3bf6932b97d2469b4fa78e28a2e8d05c586affe9c8cb66dba52543000000008a47304402206f40f4eb8c6cab7c6dd45a132d437e736a6a0dddfb2b78b10e6efbcaf61592f602200d329a57d7a0c969cc349f41852da4ba1a3bc2245e656bdd41780455b97bf84a014104aa49fbe6608076318ff09171e3c2b4a2effa52d53a417371140642996693ae3ac53ce300fff7fef650d0a2418b087a237aa6838eed3bdfad0ec0069df7209f4affffffff0190d60200000000001976a91401ddbca1a39b60b54fb671297a4a20a7681e017188ac00000000", "полный" : правда }

Оболочки Bash: расшифруйте подпись транзакции (успешной):

$ ./биткоин-Кинк -rpcpassword=123456 decoderawtransaction 01000000013ea2097dbb3bf6932b97d2469b4fa78e28a2e8d05c586affe9c8cb66dba52543000000008a47304402206f40f4eb8c6cab7c6dd45a132d437e736a6a0dddfb2b78b10e6efbcaf61592f602200d329a57d7a0c969cc349f41852da4ba1a3bc2245e656bdd41780455b97bf84a014104aa49fbe6608076318ff09171e3c2b4a2effa52d53a417371140642996693ae3ac53ce300fff7fef650d0a2418b087a237aa6838eed3bdfad0ec0069df7209f4affffffff0190d60200000000001976a91401ddbca1a39b60b54fb671297a4a20a7681e017188ac00000000

Вывод команды:

{ "txid" : "267550934eb413a623459464d88cb14ff47fa192df720cf8485b590812db8fba", "версии" : 1, "locktime" : 0, "Альвин" : [ { "txid" : "4325a5db66cbc8e9ff6a585cd0e8a2288ea74f9b46d2972b93f63bbb7d09a23e", "Uвых" : 0, "scriptSig" : { "АСМ" : "304402206f40f4eb8c6cab7c6dd45a132d437e736a6a0dddfb2b78b10e6efbcaf61592f602200d329a57d7a0c969cc349f41852da4ba1a3bc2245e656bdd41780455b97bf84a01 04aa49fbe6608076318ff09171e3c2b4a2effa52d53a417371140642996693ae3ac53ce300fff7fef650d0a2418b087a237aa6838eed3bdfad0ec0069df7209f4a", "наговор" : "47304402206f40f4eb8c6cab7c6dd45a132d437e736a6a0dddfb2b78b10e6efbcaf61592f602200d329a57d7a0c969cc349f41852da4ba1a3bc2245e656bdd41780455b97bf84a014104aa49fbe6608076318ff09171e3c2b4a2effa52d53a417371140642996693ae3ac53ce300fff7fef650d0a2418b087a237aa6838eed3bdfad0ec0069df7209f4a" }, "последовательности" : 4294967295 } ], "Uвых" : [ { "значение" : 0.00186000, "н" : 0, "scriptPubKey" : { "АСМ" : "OP_DUP OP_HASH160 01ddbca1a39b60b54fb671297a4a20a7681e0171 OP_EQUALVERIFY OP_CHECKSIG", "наговор" : "76a91401ddbca1a39b60b54fb671297a4a20a7681e017188ac", "reqSigs" : 1, "тип" : "pubkeyhash", "адреса" : [ "1AsJjnWg5QKBThM6mK9jZ8mmo6KUzDjRd" ] } } ] }

Оболочки Bash: отправлять необработанные транзакции (успешной):

./биткоин-Кинк -rpcpassword=123456 sendrawtransaction 01000000013ea2097dbb3bf6932b97d2469b4fa78e28a2e8d05c586affe9c8cb66dba52543000000008a47304402206f40f4eb8c6cab7c6dd45a132d437e736a6a0dddfb2b78b10e6efbcaf61592f602200d329a57d7a0c969cc349f41852da4ba1a3bc2245e656bdd41780455b97bf84a014104aa49fbe6608076318ff09171e3c2b4a2effa52d53a417371140642996693ae3ac53ce300fff7fef650d0a2418b087a237aa6838eed3bdfad0ec0069df7209f4affffffff0190d60200000000001976a91401ddbca1a39b60b54fb671297a4a20a7681e017188ac00000000 267550934eb413a623459464d88cb14ff47fa192df720cf8485b590812db8fba

Вывод команды: Нет вывода на успех команды!

Вывод :-)

Объяснить и сформулировать вопрос, я нашел решение. Это действительно стоит спросить на клиент StackExchange, и я должен ответить сам!

Обновление: Спасибо за комментарии - я ответил себя ниже. Обеспечить scriptPubKey является правильным и оставить redeemScript пустой для простых операций.

+166
Dave Smalz 24 мар. 2023 г., 17:43:38

ArchLinux только поддерживает ИА-32 и архитектуру x86_64. ArchLinuxARM (сигнализация для краткости), которая является отдельной, производного дистрибутива от ArchLinux, официально не поддерживает ваш аппарат.

Это может, однако, быть в тревоге сообщество поддерживает категории.

Таким образом, вы можете установить арки на любой основе ARM машина? Нет. Вы можете установить будильник на компьютере? возможно (но это не будет официально поддерживается).

+82
Stas Vlasenko 20 июл. 2023 г., 20:09:09

Прошу как сопоставить все значения в первом столбце в файле с текстовой строки в файл 2, так что я могу скопировать в формате fasta последовательностей всех ИД объекта в 1 файл?

Файл 1.CSV-файл

Аргумент Object_id, Длина, Назначение
NODE_142_length_92872_cov_11.2497,92872,2005469
NODE_405_length_50717_cov_10.7964,50717,82654
NODE_775_length_33402_cov_18.9306,33402,1147
NODE_1008_length_27630_cov_17.7829,27630,1184

Файл 2 Фаста.файл

>NODE_1_length_501653_cov_19.284
TGGTGTGAGAGGCGCACCTCGCTAACTTTTCAGTTAGCGAGGCCGTCTACTCGATTAGCT
GTTATGAGCCCGACGAGCTACCAACTGCTCCATCCCGCGATATTGTGATGCAAAGGTAAG
>NODE_142_length_92872_cov_11.2497
ATTAACTACTAAGTTACAAATTTTAGTAGCTGTCCAGTTTAAAGGAAGTATTTCATATTT
TCGCTTACGTTAAATAGGAAAAGCAAGTTCTTTTTTGAGGTACCCAGTGAGTCTGATTTT

ВЫХОДНОЙ ФАЙЛ

>NODE_142_length_92872_cov_11.2497
ATTAACTACTAAGTTACAAATTTTAGTAGCTGTCCAGTTTAAAGGAAGTATTTCATATTT
TCGCTTACGTTAAATAGGAAAAGCAAGTTCTTTTTTGAGGTACCCAGTGAGTCTGATTTT

Спасибо

+31
JessaLyn Dhale Perez Dimaano 16 дек. 2013 г., 09:38:16

Показать вопросы с тегом